On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 891 Prevotella melaninogenica AGCACTTGGTTTGAGACACGA CCGAATGGTGCTGGGGAAA 60.13 60.30 188 9
100.00% Complete
100.00%
33.33% Complete
33.33%